Answer questions at top for 40ps

Answer Questions At Top For 40ps

Answers

Answer 1
1. A timeline
2. Fossils and other ancient objects like art and diaries
3. Animals die and get buried then rock squished them and they become a fossil fuel
4. At the bottom of a canyon because more rock has built up on it which takes a higher amount of time.
5. They see how strong it is
I cannot see the available information for this question

Related Questions

researcher investigates a recently discovered species of plant. The plant has vascular tissues and exhibits a sporophyte and a gametophyte generation, but lacks seeds. How should the researcher classify the plant?

Answers

Answer:

pteridophyte

Explanation:As you might guess, Pteridophyte are plants that can move through the air. They do not make new plants by releasing seeds.

Other pteridophyte characteristics include the following:

They exhibit alternation of generations, in which the sporophyte and gametophyte generations are observed.Sporophytes are plants with true roots, stems, and leaves.Sporangia grow in clusters on sporophylls.

I hope this helps you

:)

Both plant and animal cells as well as many unicellular organisms contain

Answers

Answer:

Both plant and animal cells as well as many unicellular organisms, contain a mitochondria and nucleus which supply energy for a cell .

Explanation:

Cell is the basic functional and structural unit of life. Plant, animal as well as many unicellular organisms contain cell organelles and mitochondria which supply energy to cells.

What are different cell organelles?

Cell organelles are the structures inside a cell that floats inside the cytoplasm.

Any cell that is living has cell organelles.

Cell organelles are as follows:

Mitochondria: form ATP and provides energy to the cell.Nucleus: Brain of the cell.Ribosome: helps in protein synthesis.Endoplasmic reticulum: It helps in the transport of substances.Golgi bodies: involves in packaging.Lysosome: involved in digestion of cell.

Thus, Both plant and animal cells as well as many unicellular organisms contain organelles and mitochondria that provides energy to the cell.

For more details regarding cell organelles, visit:

https://brainly.com/question/2787889

#SPJ3

What does it mean to say that an organism is well adapted to its environment?.

Answers

When an organism is well adapted to its environment, this means that the organism is easily able to:

- withstand the climate of its habitat/environment

- regulate its bodily temperature in aforementioned climate

- use its abilities (such as eyesight, a keen sense of smell, etc.) to find nourishment or hunt prey

- safely hide, camouflage into the environment, or ward off possible attackers

Good luck on your assignment, and I hope my answer suffices.

Hey Adam are we good with you and I hope your?

Answers

Answer: yo whatever you’re going through, just don’t apologize on brainly

Explanation:

Let's review how photosynthesis works by looking at the
origin of the output molecules. Please identify which
statements are accurate.
Oxygen is consumed during the process of photosynthesis
An aquatic photosynthetic organism will produce oxygen
bubbles as it carries out photosynthesis
Only plants generate oxygen as a byproduct of photosynthesis
Glucose is consumed during the process of photosynthesis
Photosynthesis is a process that produces sugar

Answers

Answer:

Photosynthesis is a process by which green plants turn carbon dioxide and water into food using energy from sunlight.

The picture shows us how the Sun's rays strike Earth. Because of the Earth's tilt on its axis, some parts of Earth are having summer
and others, winter. What letter or letters on the Earth are experiencing summer?

A) B
B) C
C) B and C
D) C and D

Answers

Answer:

B n C

Explanation: You can tell this because when you look at the diagram it shows B and C facing the sun so that means it's summer.

Answer
D.) C and D

Explanation:

It may look like B and C, but the sun hardly reaches up in the north, plus its axis is shifted so it's not technically summer for them yet, this leaves the bottom, which will rotate and give both sides the taste of summer glory.

Once the earth rotates more, it will be summer for B. and A.
But the graph shows that the answer is

D.) C and D

How and why do organisms interact with one another?

Answers

Answer:

It's in their makeup to interact

Explanation

They need to interact to survive, to exist, to reproduce!

Answer:Organisms interact because of mating, competition for food resources, defense, and assertion of dominance.

Explanation:

Which statement presents a credible and unbiased argument for selecting a particular livestock animal as a human organ donor?
(Please help, this is a practice question btw)

A. A calf is the best candidate, because a cow's gestation period most closely matches a human's (9 months/280 days), and that feels most natural.

B. A lamb is the best candidate, because sheep are less likely to be sold as a meat source and because lambs are inherently cute.

C. A piglet is the best candidate. A pig's gestation period is the briefest, so human hearts could be more quickly grown and transplanted.

D. Livestock candidates should be chosen based on the patient's preference, otherwise there could be organ rejection.

Answers

Livestock candidates should be chosen based on the patient's preference as there could be organ rejection is an unbiased argument.

What is an Unbiased argument?

This type of argument shows the reader both sides and bids the reader decide.

The other options tends to support an animal which makes them biased but option D doesn't and has a credible reason which is why it's the most appropriate choice.

Read more about Unbiased argument here https://brainly.com/question/2399804

Movement of phloem sap from a source to a sink ________.

Answers

Bulk flow refers to the movement of phloem sap from a source to a sink in plants.

What is Phloem?

This is a vascular tissue found in plants which helps to transport and distribution of the organic nutrients derived from photosynthesis.

Bulk flow occur when these nutrients present in the phloem sap are moved  from source to sink.

Read more about Phloem here https://brainly.com/question/983997

How does a comparison of bone structures of two animal provide evidence of an evolutionary relationship

Answers

Answer: Comparative Anatomy

Both provide evidence for evolution. Homologous structures are structures that are similar in related organisms because they were inherited from a common ancestor. These structures may or may not have the same function in the descendants.

Explanation: hope it helps

mark me as brainliest ^_^

Over the course of evolution, the bones of the animals undergo a gradual change in shape as well as in size. But still, two closely related animals have an identical overall layout of the bone.

What do you mean by Evolution?

Evolution may be defined as a gradual process that involves changes or modifications in the members of the same or different species over a long period of time.  

The bones of descent common ancestors reveal the evolutionary relationships among the animals. In relationship involves homologous and analogous structures.

The homologous structure reveals the structural similarity between the animals, while the analogous structures reveal the functional similarity.

Therefore, it is well described above.

To learn more about Evolutionary relationships, refer to the link:

https://brainly.com/question/26125007

#SPJ2

Adipose tissue is one of the most hydrated of all tissues in the human body

Answers

Answer:

False

Explanation:

Adipose tissue is one of the lease hydratetd of all tissues in the human body.

Adipose tissue is one of the most hydrated of all tissues in the human body and is one of the maximum hydrated of all tissues withinside the human frame.

What is intracellular fluid?

The maximum ample cation in intracellular fluid is sodium. Solutes, irrespective of size, are capable of pass freely among booths due to the fact water includes them alongside the osmotic gradients.

Adipose tissue carries approximately 10% of water, even as muscle groups carries approximately 75%. In Netter's Atlas of Human Physiology, frame water is damaged down into the subsequent booths: Intracellular fluid (2/three of frame water) is fluid contained inside cells.

To read more about the Adipose tissue refer link :

https://brainly.com/question/546428

#SPJ4

True or False: In a box and whisker plot, 50% of the data is between Q1 and the median

Answers

Answer:

Minimum = 0%

Q1 (Lower Quartile) = 25%

Median = 50%

Q3 (Upper Quartile) = 75%

Maximum = 100%

That is true. In a box and whisker plot, Q1 is the first quartile (first 25% of the data) is between the lower quartile (Q1) and the median. The median is the middle, so 50% will fall between Q1 and the median. It's important to understand the various measures of central tendency and how they can be used to analyze the spread of data within a given set, which can provide valuable insights and understanding about the overall trends present within the data.

What is mechanical digestion? Describe the first stage of mechanical digestion.

Answers

Mechanical digestion means breaking down food mechanically. By chewing and tearing with teeth, food breaks down into smaller parts and no enzymes are used.

What is the first step in mechanical digestion?

The complex pieces of food that are eaten have to be split into simpler particles that can be acted upon by different enzymes.

This is mechanical digestion, which starts in the mouth with chewing or mastication and continues with churning and combining actions in the stomach.

Thus, this could be the answer.

To learn more about Mechanical digestion click here:

https://brainly.com/question/1283194

#SPJ1

Answer this pls!!!!!!!

What do enzymes do?

Answers

Answer:

Enzymes are proteins that help speed up metabolism, or the chemical reactions in our bodies. They build some substances and break others down.

Explanation:

When pigs reproduce, which two types of cells pass on information from the pigs to the piglets?

Answers

Answer:

nuclei

Explanation:

Nuclei male and nuclei female to create a zygote

The two type of cells that pass on information from the pigs to the piglet is the male and female reproductive cells.

What is male and female reproductive cell?

The male and female reproductive cell contains information about the parents that are passed on to the offspring.

The piglet inherit some genes from both parents through their cells.

Therefore, The two type of cells that pass on information from the pigs to the piglet is the male and female reproductive cells.

Learn more on reproductive cell,

https://brainly.com/question/1601480

#SPJ6

Could melanin granules be moved by dynein and kinesin along an actin microfilament?.

Answers

We can confirm that melanin granules could in fact not be moved by dynein and kinesin along an actin microfilament.

Why can these substances not be moved along a microfilament?

This has to do with the fact that these proteins are specific to microtubules, and therefore are not able to move along microfilaments. This is why the dynein and kinesin motor proteins would not be able to transport the granules along microfilaments.

Therefore, we can confirm that melanin granules could in fact not be moved by dynein and kinesin along an actin microfilament.

To learn more about microfilaments visit:

https://brainly.com/question/13823438?referrer=searchResults

Plants are able to engage in photosynthesis because they produce a chemical that can absorb sunlight to synthesize glucose. What is this chemical?.

Answers

Answer:

Chlorophyll

Explanation:

Plants engage in photosynthesis with the help of chlorophyll.

In the process : Carbon dioxide is used and oxigen is produced.

HEEEELLLLPPPPP
Deforestation is the second leading cause of global warming (climate change) worldwide, and it produces about 24% of global greenhouse gas emissions. Deforestation in the tropical rainforests contributes more carbon dioxide to the atmosphere than the sum of all cars and trucks that drive on the world’s roads.

Why would deforestation this lead to more carbon dioxide?

a
The changed habitats support more animals, like native birds and mammals, that produce more carbon dioxide.
b
The increased amount of timber harvested produces oxygen gas, which encourages the wildlife to generate carbon dioxide.
c
Loss of trees leads to a decrease of the ability of forests to act as carbon sinks to remove carbon dioxide from the atmosphere.
d
Equipment used for clear-cutting produce metric tons of carbon dioxide, which is released into the atmosphere during the process of deforestation

Answers

Answer:

C

Explanation:

According to Worldwildlife.org, Forest play a critical role in mitigating climate change because they act as a carbon sink - soaking up carbon dioxide that otherwise be free in the atmosphere and contribute to ongoing changes in climate patterns.

HELP ME!!!!! What is an important part of scientific methods? there is more then one answer so Select all correct answers.

A. establishing state of the art labs

B. forming conclusions

C. making hypothesis

D. using computers

Answers

Answer:

B and C

Explanation:

establishing state of the art labs isn't a part of the scientific method and neither is using computers

can the shape of globin change ?

Answers

Answer:

People with the sickle cell mutation in both copies of the HBB gene produce proteins that clump together and lead to changes in the shape and behavior of red blood cells.

please what is meant by photosynthesis​

Answers

Answer:

Photosynthesis is a process used by plants and other organisms to convert light energy into chemical energy that, through cellular respiration, can later be released to fuel the organism's activities. Some of this chemical energy is stored in carbohydrate molecules, such as sugars and starches, which are synthesized from carbon dioxide and water, In most cases, oxygen is also released as a waste product that stores three times more chemical energy than the carbohydrates. Most plants, algae, and cyanobacteria perform photosynthesis; such organisms are called photoautotrophs. Photosynthesis is largely responsible for producing and maintaining the oxygen content of the Earth's atmosphere, and supplies most of the energy necessary for life on Earth.

Explanation:

What happens to the lac operon when both glucose and lactose are present?

Answers

Answer:

If both glucose and lactose are both present, lactose binds to the repressor and prevents it from binding to the operator region. The block of lac gene transcription is thus lifted, and a small amount of mRNA is produced.

Explanation:

What is the shape of DNA when it is not undergoing replication?

Answers

Explanation:

If DNA replication does not occur, then the cell cycle will not proceed to the next stage and the subsequent division will not happen. It will lead to cell death.

Florida experiences a lot of rain in the summer months. How do plants respond to this?

Answers

Answer:

They Start to Sprout and bud

Answer:

They grow more and produce flowers or fruit.

Explanation:

I got it right on my quiz haha

Hope this helped/helps!!

Have a nice day alsooo!

Which mrna sequences would form a structure that is a cue for transcription termination of some genes?

Answers

Answer:

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

Explanation:

Those mRNA sequences that consist of the stop codons like UAA, UGA, and UAG would form a structure that is a cue for transcription termination of some genes.

What do you mean by Transcription?

Transcription may be defined as the process by which the information in a strand of DNA is copied into a new molecule of messenger RNA (mRNA).

Stop codons are responsible for the termination of transcription of almost all the genes. They are necessary for inhibiting the excessive expression of some genes.

Therefore, those mRNA sequences that consist of the stop codons like UAA, UGA, and UAG would form a structure that is a cue for transcription termination of some genes.

To learn more about Transcription, refer to the link:

https://brainly.com/question/1048150

#SPJ4

Identify the independent variable in the experiment represented in Figure 3B. Justify the use of hair from individuals unaffected with FT as the control in the experiment represented in Figures 3A and 3B. Based on the data in Figure 3B, describe the FT effect of the disorder on the proportion of hairs in the growth phase. Based on Figure 2, if individuals 3 and 4 have another child, calculate the probability that the child will be affected

Answers

Based on the experimental data, the independent variable is the protein fibroblast growth factor-5, FGF5 which is unaffected by hair growth.

What is FT?

Familial trichomegaly, FT, is a genetic disorder which results in abnormally long eyes in affected individuals.

FT is caused by a mutation in the genes that coded for the protein fibroblast growth factor-5, FGF5.

In research, the independent variable is unaffected by changes in another variable, butis changed and controlled by the researcher.

Based in the experiments, the independent variable is the protein fibroblast growth factor-5, FGF5.

Therefore, the independent variable is the protein fibroblast growth factor-5, FGF5 which is unaffected by hair growth.

Learn more about independent variable at: https://brainly.com/question/82796

Which of the following is the most likely flow of energy in an aquatic ecosystem? a. phytoplankton → mammal → zooplankton → fish b. phytoplankton → zooplankton → fish → mammal c. zooplankton → phytoplankton → mammal → fish d. mammal → fish → zooplankton → phytoplankton

Answers

The flow of energy in an aquatic ecosystem phytoplankton → zooplankton → fish → mammal.

What does the bottom-up model?

The bottom-up effect means that a lower trophic level in the biological network affects the community structure of higher trophic levels by means of resource restriction.

whereas the top-down effect refers to a higher trophic level that influences the community structure of a lower trophic level through predation.

Thus, opotion "B" is correct.

To learn more about the bottom-up model click here:

https://brainly.com/question/5364844

S
11. Evaluate how a person's blood calcium levels
would be affected if his or her thyroid gland
stopped working.

Answers

our thyroid glands plays a main role in a human body. It secretes thyroxine and calcitonin. In which thyroxine help in growth and cellular metabolism and calcitonin helps to regulates calcium concentration in blood . If thyroid gland stops working then there is low level of calcium in our blood, which leads to mental and hormonal disorder. In this way a person's blood calcium level would be affected if his/her thyroid gland stops working.

What prevents the blood in veins from flowing in the wrong direction?.

Answers

Answer:

The heart valves

Explanation:

The heart valves prevent blood from flowing in the wrong direction in the heart. The valves are held in the proper place because of the chordae tendinae.

What organism meets the criteria for group b? question 3 options: hammerhead shark emperor penguin rattle snake box turtle

Answers

Emperor penguin meets the criteria for Group B.

The Emperor penguin is an organism that meets the criteria for group b.

Are penguins Endotherm or Ectotherm?

Endotherms: Penguins, and prairie dogs, like most other birds and mammals, are endotherms. Iguanas and rattlesnakes, like most other reptiles along with most fishes, amphibians, and invertebrates are ectotherms.

Endotherms generate most of the heat they need internally.

Thus, the emperor penguin is an organism that meets the criteria for group b.

To learn more about penguins click here:

https://brainly.com/question/311514

Other Questions
hola alguien Abla espaol? me pueden decir cmo cambiar de idioma por favor A sample of radium has a weight of 1.5 mg and a half-life of approximately 6 years.a. How much of the sample will remain after 6 years? Health care providers use the Self-Referral Disclosure Protocol (SRDP) to report all suspected fraud & abuse. true or false What gift did you give to a friend last year? Answer question in Spanish using the verb "dar"Make sure it's a store bought gift. What element of the federal government is established by Article III of theConstitution?O A. The principles that will guide the countryO B. The structure and role of the legislative branchC. The structure and role of the executive branchO D. The structure and role of the judicial branch Expand the binomial (3x^2+2y^3)^4 READ THIS ANSWER QUESTIONS IN SPANISHBanco de arenques a babor! anunci la gaviota viga, y la bandada del Faro de la Arena Roja recibi la noticia con graznidos de alivio.Llevaban seis horas de vuelo sin interrupciones y, aunque las gaviotas piloto las haban conducido por corrientes de aires clidos que hicieron placentero el planear sobre el ocano, sentan la necesidad de reponer fuerzas, y qu mejor para ello que un buen atracn de arenques.Volaban sobre la desembocadura del ro Elba, en el mar del Norte. Desde la altura vean los barcos formados uno tras otro, como si fueran pacientes y disciplinados animales acuticos esperando turno para salir a mar abierto y orientar all sus rumbos hacia todos los puertos del planeta.A Kengah, una gaviota de plumas color plata, le gustaba especialmente observar las banderas de los barcos, pues saba que cada una de ellas representaba una forma de hablar, de nombrar las mismas cosas con palabras diferentes.Qu difcil lo tienen los humanos. Las gaviotas, en cambio, graznamos igual en todo el mundo coment una vez Kengah a una de sus compaeras de vuelo.As es. Y lo ms notable es que a veces hasta consiguen entenderse grazn la aludida.Ms all de la lnea de la costa, el paisaje se tornaba de un verde intenso. Era un enorme prado en el que destacaban los rebaos de ovejas pastando al amparo de los diques y las perezosas aspas de los molinos de viento.Siguiendo las instrucciones de las gaviotas piloto, la bandada del Faro de la Arena Roja tom una corriente de aire fro y se lanz en picado sobre el cardumen de arenques. Ciento veinte cuerpos perforaron el agua como saetas y, al salir a la superficie, cada gaviota sostena un arenque en el pico. Sabrosos arenques. Sabrosos y gordos. Justamente lo que necesitaban para recuperar energas antes de continuar el vuelo hasta Den Helder, donde se les unira la bandada de las islas Frisias.El plan de vuelo tena previsto seguir luego hasta el paso de Calais y el canal de la Mancha, donde seran recibidas por las bandadas de la baha del Sena y Saint Malo, con las que volaran juntas hasta alcanzar el cielo de Vizcaya.Para entonces seran unas mil gaviotas que, como una rpida nube de color plata, iran en aumento con la incorporacin de las bandadas de Belle lle, Olron, los cabos de Machichaco, del Ajo y de Peas. Cuando todas las gaviotas autorizadas por la ley del mar y de los vientos volaran sobre Vizcaya, podra comenzar la gran convencin de las gaviotas de los mares Bltico, del Norte y Atlntico.Sera un bello encuentro. En eso pensaba Kengah mientras daba cuenta de su tercer arenque. Como todos los aos, se escucharan interesantes historias, especialmente las narradas por las gaviotas del cabo de Peas, infatigables viajeras que a veces volaban hasta las islas Canarias o las de pls help me my homework the question is below please help by monday HELPPPPP I AM STUCK ! Explain how production gives form utility to natural resources. Read this sentence from Anne Frank: A Diary of a Young Girl.I would like to ask God to give me a different nature, so that I didn't put everyone's back up.Which statement best interprets the meaning of the word nature?Its denotation is "unavoidable;" its connotation is "personality."Its denotation is "changeable;" its connotation is "genetic."Its denotation is "genetic;" its connotation is "changeable."Its denotation is "personality;"; its connotation is "unavoidable." Why was there a shortage of workers in the Roman Empire State the domain and range and determine if it's a function?Help!!! A garbage can of mass 12 kg standing on horizontal ground is pushed by a horizontal force of 40N. If the coefficient of static friction is 0. 32 and the coefficient of dynamic orkinetic friction is 0. 24 between the can and ground, the acceleration of the garbage can is____ m/s2 Help help help help help The equation h = 7 sine (startfraction pi over 21 endfraction t) 28 can be used to model the height, h, in feet of the end of one blade of a windmill turning on an axis above the ground as a function of time, t, in seconds. how long is the blade? assume that the blade is pointing to the right, parallel to the ground, at t = 0, and that the windmill turns counterclockwise at a constant rate. 7 feet 14 feet 21 feet 28 feet Question 3 of 10Look at the chart below, which represents the Spanish caste system. Whichterm would fit in the fourth box of the chart in order to reflect the Spanishcaste system?PeninsularesCreolesSpanishCaste SystemA. MulattosB. Enslaved AfricansC. Free AfricansD. Mestizos Joseph was given a large box of 54 chocolates for his birthday. if he eats exactly 5 chocolates each day, how many chocolates would joseph have remaining 8 days after his birthday? A manager drew this box-and-whisker plot to represent the number of minutes each of his 27 employees took on their break. Each employee took a different amount of time.How many employees took a break longer than 49 minutes?Enter your answer in the box. What happens when light waves strike a mirror? question 5 options: most of the light waves are refracted. most of the light waves are absorbed. most of the light waves are scattered. most of the light waves are reflected.